output/EGFP/Egfp_dsRNA_region.txt Version 1
_p_RNAinVAL/_I_01_LabTrials/_S_01_TargetSelect/_A_08_SelTargetsA-dry/
SEEK ID: https://testing.sysmo-db.org/data_files/1945?version=1
Filename:
output/EGFP/Egfp_dsRNA_region.txt
Format: Plain text document
Size: 438 Bytes
>egfp_Guo2015 CCACAAGTTCAGCGTGTCCGGCGAGGGCGAGGGCGATGCCACCTACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGACCACATGAAGCAGCACGACTTCTTCAAGTCCGCCATGCCCGAAGGCTACGTCCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCATCGACTTCAAGGAGGACGGCAACATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAACGTCTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTT
Export PNG
Creators and Submitter
Views: 1019 Downloads: 47
Created: 10th Nov 2021 at 15:10
Last updated: 10th Nov 2021 at 15:10
AttributionsNone
Version History
Version 1 (earliest) Created 10th Nov 2021 at 15:10 by Andrej Blejec
No revision comments
Related items
Projects: testUpload, Test project 2019-10-30 11:13:00, Test project 2019-10-30 11:09:39, Test project 2019-11-02 19:40:30, Test project for pISA (104), _p_stRT, _p_Demo, Bla, Test project abcd, Test project 2021-07-18 22:00:39, Test project 2021-07-18 22:45:54, Test project 2021-07-18 23:08:33, Test project 2021-07-18 23:23:02, Test project 2021-07-21 00:08:04, Test project 2021-07-21 00:17:06, Test project 2021-07-21 00:18:25, Test project 2021-08-20 22:56:43, Testing of upload, _p_RNAinVAL
Institutions: National Institute of Biology, NIB, <script>alert('xss-institution-title')</script> & Test Institution
https://orcid.org/0000-0001-7484-6031
Local data management; testing uploading/downloading using API
Projects: testUpload, *, New project, New project 1, Test Project 7, Test Project, Test Project 8, Test Project 9, Test Project 10, Test Project 11, Test Project 12, Test Project 14, Test Project 13, Test Project 15, Test Project 16, Test Project 17, Test Project 18, Test: investigations 2019-10-30 11:00:08, Test: investigations 2019-10-30 11:02:00, Test project 2019-10-30 11:04:02, Test project 2019-10-30 11:08:47, Test project 2019-10-30 11:09:39, Test project 2019-10-30 11:10:03, Test project 2019-10-30 11:13:00, Test project 2019-11-01 11:41:43, Test project 2019-11-01 11:44:23, Test Project 20, Test project 21 2019-11-01 11:44:23, Test Project 21, Test project 23 2019-11-01 11:44:23, Test project 24 2019-11-01 11:44:23, Test project 33 2019-11-01 11:57:55, Test project 2019-11-01 12:01:35, Test project 40 2019-11-01 11:57:55, Test project 41 2019-11-01 11:57:55, Test project 42 2019-11-01 11:57:55, Test project 43 2019-11-01 11:57:55, Test project 44 2019-11-01 11:57:55, Test project 47 2019-11-01 11:57:55, Test project 48 2019-11-01 11:57:55, Test project 2019-11-01 19:36:07, Test project 2019-11-02 19:35:45, Test project 2019-11-02 19:40:30, Test project 50 2019-11-01 11:57:55, Test project 2019-11-02 19:47:45, Test project 51 2019-11-01 11:57:55, Test project 2019-11-02 20:22:36, Test project 2019-11-02 22:06:58, Test project 2019-11-02 22:10:04, Test project for pISA (104), _p_stRT, Test project 2019-11-13 21:46:46, Test project 2019-11-13 21:57:39, Test project 2019-11-13 21:59:51, Test project 2021-07-12 18:25:58, _p_Demo, Bla, Test project 2021-07-14 20:52:52, Test project 2021-07-14 20:54:23, Test project 2021-07-14 20:57:21, Test project 2021-07-15 23:13:46, Test project 2021-07-15 23:14:58, Test project 2021-07-15 23:16:29, Test project 2021-07-16 18:42:56, Test project 2021-07-16 18:43:56, Test project 2021-07-16 18:58:32, Test project 2021-07-16 19:00:28, Test project 2021-07-16 19:14:43, Test project 2021-07-16 19:17:03, Test project 2021-07-16 20:07:34, Test project 2021-07-17 20:31:23, Test project 2021-07-17 20:49:21, Test project abc, Test project abcd, Test project abcde, Test project 2021-07-18 21:54:46, Test project 2021-07-18 22:00:39, Test project 2021-07-18 23:08:33, Test project 2021-07-18 23:23:02, Test project 2021-07-21 00:08:04, Test project 2021-07-21 00:17:06, Test project 2021-07-21 00:18:25, Test project 2021-08-20 22:56:43, Testing of upload, _p_RNAinVAL
Web page: Not specified
Test upload using seekr before upload to FAIRDOMHub
Programme: pISA-tree
Public web page: Not specified
Short Name: 01_LabTrials Title: Laboratory trials Description: Selection of targets and their validation in trials performed in the laboratories and greenhouse at NIB Phenodata: ./phenodata_20210113.txt pISA Investigation creation date: 2021-01-13 pISA Investigation creator: Marko Petek Principal investigator: Marko Petek License: CC BY 4.0 Sharing permission: Private Upload to FAIRDOMHub: Yes
Submitter: Andrej Blejec
Studies: Investigation files, _S_01_TargetSelect, _S_02_dsRNAorder, _S_03_dsRNAprod, _S_04_Stages, _S_05_jun2016, _S_06_oct2016, _S_07_dec2016, _S_08_jan2017, _S_09_jun2017, _S_10_apr2018, _S_11_may2018
Assays: _A_00_Ecoli-dry, _A_00_dsRNA_stabil-wet, _A_01-phenotyping, _A_01-phenotyping, _A_01-phenotyping, _A_01-phenotyping, _A_01-phenotyping, _A_01_AgroRNA-wet, _A_01_LitData-dry, _A_01_pIsol-wet, _A_02-RNAisol, _A_02-RNAisol, _A_02-RNAisol, _A_02_UlrichTop100-BLAST, _A_02_plasmid-SangerSeq, _A_02_qPCR_ampl_test-wet, _A_03-qPCR, _A_03-qPCR, _A_03-qPCR, _A_03_RNaseItreat-wet, _A_03_patentDB-BLAST, _A_03_stages-RNAisol, _A_04_ortho-BLAST, _A_04_prod-qPCR, _A_04_stages-qPCR, _A_05_CPB_gene-annot, _A_06_splitter_BLAST-dry, _A_07_MergeEvi-dry, _A_08_SelTargetsA-dry, _I_01_LabTrials-files, _S_01_TargetSelect-files, _S_02_dsRNAorder-files, _S_03_dsRNAprod-files, _S_04_Stages-files, _S_05_jun2016-files, _S_06_oct2016-files, _S_07_dec2016-files, _S_08_jan2017-files, _S_09_jun2017-files, _S_10_apr2018-files, _S_11_may2018-files
Short Name: 01_TargetSelect Title: Search for genes that might be good targets for control using dsRNAs (RNAi pesticides) Description: We will examine the results of RNAi screening experiments in model organisms (e.g. Drosophila melanogaster, Tribolium castaneum) as well as employ our previous data and literature knowledge on CPB gene expression and physiology Raw Data: pISA Study creation date: 2021-01-13 pISA Study creator: Marko Petek Principal investigator: Marko Petek License: CC BY 4.0 ...
Short Name: 08_SelTargetsA-dry Assay Class: DRY Assay Type: dry Title: Bioinformatics analyses for individual selected target genes Description: In depth bioinformatic analysis for each target gene using various tools to predict possible off-target effects and select a fragment sequence for dsRNA synthesis pISA Assay creation date: 2021-01-14 pISA Assay creator: Marko Petek Phenodata: None Featuredata: Data:
Submitter: Andrej Blejec
Assay type: Experimental Assay Type
Technology type: Technology Type
Investigation: _I_01_LabTrials
Study: _S_01_TargetSelect
